edgaras/strsim

Collection of string similarity and distance algorithms in PHP including Levenshtein, Damerau-Levenshtein, Jaro-Winkler, and more

Installs: 2 045

Dependents: 0

Suggesters: 0

Security: 0

Stars: 11

Watchers: 1

Forks: 1

Open Issues: 1

pkg:composer/edgaras/strsim

v1.1.0 2025-09-25 12:11 UTC

This package is auto-updated.

Last update: 2025-09-25 12:13:11 UTC


README

A collection of string similarity and distance algorithms implemented in PHP with full Unicode and multibyte character support. This library provides standalone static methods for computing various similarity metrics, useful in natural language processing, fuzzy matching, spell checking, and bioinformatics.

Requirements

  • PHP 8.3+
  • Composer

Installation

  1. Use the library via Composer:
composer require edgaras/strsim
  1. Include the Composer autoloader:
require __DIR__ . '/vendor/autoload.php';

Features

  • Full Unicode Support: All algorithms handle multibyte characters, emoji, combining marks, and complex grapheme clusters
  • UTF-8 Validation: Automatic validation of input strings with clear error messages
  • Error Handling: Proper exception types with descriptive messages
  • Code-Point Based: Consistent behavior across all Unicode normalization forms
  • Optimized Tokenization: Smart whitespace handling for text-based algorithms

Supported Algorithms

Class Method Description
Levenshtein distance() Measures the number of insertions, deletions, or substitutions.
DamerauLevenshtein distance() Levenshtein with transpositions included.
Hamming distance() Counts differing positions (requires equal-length strings).
Jaro distance() Measures similarity based on character matches and transpositions.
JaroWinkler distance() Jaro with a prefix match boost for similar string starts.
LCS length() Returns the length of the longest common subsequence.
SmithWaterman score() Local alignment scoring for best-matching subsequences.
NeedlemanWunsch score() Global alignment scoring for entire string similarity.
Cosine similarity() Measures similarity via character frequency vectors.
Cosine similarityFromVectors() Computes cosine similarity for numeric vector inputs.
Jaccard index() Ratio of shared to total unique characters.
MongeElkan similarity() Average best-word similarity using Jaro-Winkler internally.

Usage

Basic Usage

use Edgaras\StrSim\Levenshtein;
use Edgaras\StrSim\DamerauLevenshtein;
use Edgaras\StrSim\Hamming;
use Edgaras\StrSim\Jaro;
use Edgaras\StrSim\JaroWinkler;
use Edgaras\StrSim\LCS;
use Edgaras\StrSim\SmithWaterman;
use Edgaras\StrSim\NeedlemanWunsch;
use Edgaras\StrSim\Cosine;
use Edgaras\StrSim\Jaccard;
use Edgaras\StrSim\MongeElkan;

// Detecting spelling error distance in user input
Levenshtein::distance("kitten", "sitting");  // Returns: 3

// Detecting typo distance with transposition correction
DamerauLevenshtein::distance("abcd", "acbd");  // Returns: 1

// Bit-level error detection (equal-length only)
Hamming::distance("1011101", "1001001");  // Returns: 2

// Comparing short strings with transposition support
Jaro::distance("dixon", "dicksonx");  // Returns: 0.767

// Matching names with common prefixes
JaroWinkler::distance("martha", "marhta");  // Returns: 0.961

// Finding common subsequence in DNA fragments
LCS::length("ACCGGTCGAGTGCGCGGAAGCCGGCCGAA", "GTCGTTCGGAATGCCGTTGCTCTGTAAA"); // Returns: 13

// Local alignment score for substring match
SmithWaterman::score("ACACACTA", "AGCACACA");  // Returns: 11

// Global alignment score for complete sequence match
NeedlemanWunsch::score("GATTACA", "GCATGCU");  // Returns: 0

// Comparing word frequency in short texts
Cosine::similarity("night", "nacht");  // Returns: 0.6

// Comparing embedding vectors from NLP model
Cosine::similarityFromVectors([0.1, 0.2, 0.3], [0.1, 0.3, 0.4]);  // Returns: 0.925

// Comparing token overlap in short strings
Jaccard::index("abc", "bcd"); // Returns: 0.5

// Fuzzy match between two multi-word names
MongeElkan::similarity("john smith", "jon smythe");  // Returns: 0.822

Unicode and Multibyte Examples

// All algorithms support Unicode characters
Levenshtein::distance("café", "caffe");  // Returns: 2
Levenshtein::distance("こんにちは", "こんにちわ");  // Returns: 1

// Emoji and complex characters
Levenshtein::distance("🚀🌟", "🚀⭐");  // Returns: 1
Hamming::distance("👍🏽", "👍🏾");  // Returns: 1

// Different scripts and languages
Jaro::distance("привет", "привет");  // Returns: 1.0
JaroWinkler::distance("عربي", "عربى");  // Returns: 0.9

// ZWJ sequences and combining marks
Levenshtein::distance("👨‍👩‍👧‍👦", "👨👩👧👦");  // Returns: 3
Levenshtein::distance("é", "e\u{0301}");  // Returns: 2

Custom Scoring

// Smith-Waterman with custom scoring
SmithWaterman::score("ACGT", "ACGT", match: 5, mismatch: -2, gap: -1);  // Returns: 20

// Needleman-Wunsch with custom parameters
NeedlemanWunsch::score("ACGT", "ACGT", match: 3, mismatch: -1, gap: -2);  // Returns: 12

// Jaro-Winkler with custom prefix scaling
JaroWinkler::distance("prefix_test", "prefix_demo", 0.2);  // Custom scale factor

Error Handling

try {
    // This will throw InvalidArgumentException for unequal lengths
    Hamming::distance("abc", "abcd");
} catch (InvalidArgumentException $e) {
    echo $e->getMessage(); // "Strings must be of equal length."
}

try {
    // This will throw InvalidArgumentException for invalid UTF-8
    Levenshtein::distance("valid", "\xFF\xFF");
} catch (InvalidArgumentException $e) {
    echo $e->getMessage(); // "Input strings must be valid UTF-8."
}

try {
    // This will throw InvalidArgumentException for mismatched vector lengths
    Cosine::similarityFromVectors([1, 2], [1, 2, 3]);
} catch (InvalidArgumentException $e) {
    echo $e->getMessage(); // "Vectors must be the same length."
}

Useful links